Showing posts with label National Geographic. Show all posts
Showing posts with label National Geographic. Show all posts

Friday, April 04, 2008

Pick of the Week, Cesar's Way! or I have a job, two or maybe three!

Momo is our little Shiba Inu. She will be 11 years old this September. That is like 77 in human years! She is a very spry 77 year old. We walk her every night but frankly, even after nearly 3 years of Cesar's method, she still walks robustly on lead. We decided to get her a pack so she could have a job! We put a one pound weight in each pouch and she is ready to go. She loved it immediately. You can see the pride in her walk as she wears it. It is as if she says-"look at me, I'm working!" The Shiba Inu is not a working dog, but she acts like she is. She has way more energy than the Siberian Huskies we owned. (and sorry all you Sibe owners, but she is way nicer) She even carries her own "poo" baggies just in need of emergency!

I whole heartedly recommend "The Dog Whisperer" on the National Geographic Channel. Check it out!

When she is not carrying her weight, she is working her second job-guarding Pooh for Cecilia.





Her third job? Giving us love!

Tuesday, June 26, 2007

I've been waiting for 2 months!


This is me:

ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTA
CCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATT
ACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTG
TAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAG
CAAGTACAGCAATCAACCCCCAACTATCACACATCAACTGCAACTCCAAAG
CCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTAC
ATAGCACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTT
CTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCACCATCC
TCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCC
CATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTA
CTTCAGGGCCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACA
TCACGATG

Now here comes the tale......

One night about 2 months ago I couldn't sleep. (This is a common occurrence). While laying in bed I was trolling around the stations and stopped on our local channel 24 news. The news anchor man was talking about a project with National Geographic, where they were (and
apparently have been) gathering DNA samples from around the world in an effort to map the human genome. I went to the National Geographic site and found that it is called "The Genographic Project".
I am sure you remember the Time Magazine cover about how "Eve" was from Africa. Well...apparently they have traced back the human race to one woman. Of course they say it was thousands of years ago (which I don't believe), but what is so interesting is that they admit it is possible we all come from one woman. Even more amazing is that they call her "Eve".
In my insomnia state, I decided to order a kit! I received the swab kit and did the cheek samples. I sent the samples back and have been waiting. Today the results were posted and I am totally amazed! First of all, the above map is my ancestors journey. I must admit, I don't completely understand all that was said, but I do get a few things....here is some of what they said about my DNA:

Haplogroup K: Your Branch on the Tree

Ancestral line: "Eve" > L1/L0 > L2 > L3 > N > R > K

We finally arrive at your own clan, a group of individuals who descend from a woman in the R branch of the tree. Because of the great genetic diversity found in haplogroup K, it is likely that she lived around 50,000 years ago.

Interestingly, her descendants gave rise to several different subgroups, some of which exhibit very specific geographic homelands. The very old age of these subgroups has led to a wide distribution; today they harbor specific European, northern African, and Indian components, and are found in Arabia, the northern Caucasus Mountains, and throughout the Near East.

While some members of your haplogroup headed north into Scandinavia, or south into North Africa, most members of your haplogroup K stem from a group of individuals who moved northward out of the Near East. These women crossed the rugged Caucasus Mountains in southern Russia, and moved on to the steppes of the Black Sea.

Interestingly, your haplogroup is also very significant because some specific lineages within this group constitute three of the four major Ashkenazi Jewish founding lineages. In fact, around one third of all Ashkenazi Jews trace their mitochondrial lineage back to one of four women, three of which lie within haplogroup K. Haplogroup K is found in 30 percent of Ashkenazi samples and in 6 to 7 percent of non-Jewish Europeans. While this lineage is found at a smaller frequency in non-Ashkenazi Jews, the specific three K lineages that helped found the Ashkenazi population are seldom found in other populations. It is therefore likely the case that individuals bearing one of these three lineages are Ashkenazi. However, individuals within haplogroup K that do not bear one of these three lineages are unlikely to have an Ashkenazi background. To learn more about your specific lineage within haplogroup K, you can opt-in with Family Tree DNA at the bottom of your results page where it reads, Learn More.

The term "Ashkenazi" refers to Jews of mainly central and eastern European ancestry. Most historical records indicate that the founding of Ashkenazi Jewry took place in the Rhine Basin where it subsequently underwent vast population expansions. In more recent times, the Ashkenazi population was estimated at approximately 25,000 individuals around 1300 A.D., whereas that number had increased to about 8,500,000 individuals by the turn of the twentieth century.

Around half of all Ashkenazi Jews trace their mitochondrial lineage back to one of four women, and your haplogroup K represents a lineage that gave rise to three of them. While this lineage is found at a smaller frequency in non-Ashkenazi Jews, the three K lineages that helped found the Ashkenazi population are seldom found in other populations. While virtually absent in Europeans, they appear at frequencies of three percent or higher in groups from the Levant, Arabia, and Egypt. This indicates a strong genetic role in the Ashkenazi founder event, which likely occurred in the Near East.

Today, K has given rise to three of the four most common haplogroups in Ashkenazi Jews and is currently shared by over 3,000,000 people.

Now....I don't even think I can understand all of this (there were pages more about their general findings on everyone), but a couple of things stand out. First, we all go back to one woman who came out of Africa. I happen to believe in the literal interpretation of the Bible. And guess what? There was one woman! (Eve). And she came from a garden somewhere near Israel. (I believe there was one continent at the time). I also believe there was a flood and there is evidence of all over the world. Second, isn't it interesting that my DNA analysis shows "around half of all Ashkenazi Jews trace their mitochondrial lineage back to one of four women"? Why is this interesting? Well....there were 4 women who came off the ark. There was Noah's wife and his 3 son's wives. How amazing is that?

Another personal point of interest said "my ancestors went to the Caucasus Mountains in southern Russia", which reminded me of a person I met in the late 70's. He asked me if I was from Russia. I said..."NO". He thought I looked like people he had visited who were from there. How interesting is that?

I find it all so intriguing! I don't know why. It doesn't really tell me anything in the recent past, but it does reinforce the reality of God and His Son, Jesus. I learned another thing as I was searching who the "Ashkenazi" Jews were and that is that you can have a DNA test to find out if you are a descendant of the Jewish Priest, Aaron. Now really, why would anyone care? Maybe because Israel is the key to what is going on in the world and one day (I believe very soon) Israel will rebuild their temple and start having sacrifice again and will need priests. Hummmm....... I guess it would be handy to know if you were a descendant of Aaron.

Today was an amazing day. For the life of me, I can't understand why people don't believe in God and especially after receiving this information today I don't understand why people don't see the truth. If we can get past the millions-of-years talk....several things are very clear: we come from 4 women and ultimately 1 woman. What an amazing thing!